Analysis of Recombinant Plasmid Clones - Dna Fingerprinting Using Pcr
Autor: lht150230 • October 19, 2018 • Lab Report • 1,096 Words (5 Pages) • 1,146 Views
Experiment 6, 7 - Lab Report
Lab 6. Analysis of recombinant plasmid clones
Lab 7. DNA Fingerprinting Using PCR
This report is worth 30 points, must be typed, and is due at your next scheduled lab period. Please re-type the question before typing your answer. Calculations, formulas, tables, and graphs may be hand written. The term “publishable” means that all the necessary components (including a figure caption) required for publication in a scientific journal are present and correct.
- 3 pts Attach your signed flowchart
(see attached)
- (4pts). In a publishable manner, present a figure of the gel electrophoresis results of plasmid DNA digest. Explain the obtained results.
Gel Electrophoresis of SacI Digested Plasmids
[pic 1]
Figure 1
1% agarose gel run in 1XTAE buffer at 140V for 1.5 hours to separate plasmid DNA fragments after restriction digest with SacI restriction enzyme. Visualized using GelRed Nucleic Acid stain under UV. Marked with O'RangeRuler™ 500 bp DNA Ladder in well #5. Wells #1 and #2 contained SacI digested plasmid DNA from 2 separate colonies from the previous transformation plating experiment. Well #3 contained SacI digested plasmid DNA provided by the instructor, and well #4 contained undigested plasmid DNA that was provided by the instructor.
What was the orientation of the insert in the clone?
The orientation was clockwise. We see 2 fragments in wells #2 and #3. Using the cleaner sample in well #3 (because well #2 was from a “dirty” ligation, and contained RNA that pulled the samples down), comparison with the DNA ladder indicates that the fragment sizes are about 2.5kb and 5kb, which are the expected fragments for clones with clockwise inserts.
Was that the expected clone?
Yes, this was the expected orientation for plasmid clones that expressed beta-galactosidase production.
If the clone was as expected, how would you proceed with your experiment?
The next step would be to use the plasmid DNA to transfect mammalian cells to see if it is possible to express beta-galactosidase, a bacterial protein, under a mammalian promoter.
What would you expect to see after mammalian cells’ transfection with plasmid DNA?
Since there are areas of homology with the bacterial and mammalian promoter, I would expect some success with the transfection and protein expression, so there would be some blue and some white cells.
- (3 pts) You want to amplify the following sequence using PCR:
ATGCCGTTGCGGCCAATTTAGCGCGGGATTAGCTTACTTTATCGGGTTAAT
Design primers that you can use for amplification, write them in 5’ to 3’ order, indicate which one is forward and which one is reverse and underline the primer sequences on the original sequence.
Forward primer: ATGCC
Reverse primer: ATTAA
- (8 pts) In a publishable manner, present a figure of the gel electrophoresis results of the Alu insertion and the VNTR PCR amplification experiment
Gel Electrophoresis of PCR Amplified Alu and VNTR fragments
[pic 2]
Figure 2
Agarose gel electrophoresis run to analyze presence of Alu insertion and VNTRs in student DNA. The top was done with Alu insertion fragments from chromosome 16 and the bottom contains VNTRs from chromosome 1. Visualized using GelRed Nucleic Acid stain under UV. Marked with 100bp DNA Ladder in well #11 and 500 bp DNA Ladder in well #20. The other wells contained student samples.
...